View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14433_low_18 (Length: 266)
Name: NF14433_low_18
Description: NF14433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14433_low_18 |
 | |
|
| [»] scaffold0027 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0027 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 5 - 248
Target Start/End: Complemental strand, 32145 - 31902
Alignment:
| Q |
5 |
aggtttattccattgacnnnnnnnttaatgcataccaagttattgttactgttatgattctcagaggctttggaatcaacatggagagaggaacgagaca |
104 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32145 |
aggtttattccattgacaagaaaattaatgcataccaagttattgttattgttatgattctcagaggctttggaatcaacatggagagaggaacgagaca |
32046 |
T |
|
| Q |
105 |
agcaacgagttaactcagcgaagagttgttcatcatcgtcactttcggtttcgcttgaagcagcaagagaatcgatcggtgaactgagatcagagcaagc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32045 |
agcaacgagttaactcagcgaagagttgttcatcatcgtcactttcggtttcgcttgaagcagcaagagaatcgatcggtgaactgagatcagagcaagc |
31946 |
T |
|
| Q |
205 |
gaatccataaggaaaaagcagaggatcttcaccattgttgaaaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31945 |
gaatccataaggaaaaagcagaggatcttcaccattgttgaaaa |
31902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University