View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14433_low_22 (Length: 243)
Name: NF14433_low_22
Description: NF14433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14433_low_22 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 13596 - 13825
Alignment:
| Q |
1 |
ctccagagaaaaaagacctgaaattttttagccttttgttaaagaaacttttggtcttgtgaatggtttttcttaggtgcaccattgtgaaagaatgtgg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13596 |
ctccagagaaaaaagacctgaagttttttagccttttgttaaagaaacttttggtcttgtgaatggtttttcttaggtgcaccattgtgaaagaatgtgg |
13695 |
T |
 |
| Q |
101 |
ctctctctaaatggcgttgtcttctagagctgtcatagttttaatctggtttagctcttgtataatctccaattttgtcctaattcagattccaaaatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13696 |
ctctctctaaatggcgttgtcttctagagctgtcatagttttaatctggtttagctcttgtataatctccaattttgtcctaattcagattccaaaatta |
13795 |
T |
 |
| Q |
201 |
atagatgtggacatgatgataacttgtttg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13796 |
atagatgtggacatgatgataacttgtttg |
13825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University