View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14433_low_26 (Length: 210)
Name: NF14433_low_26
Description: NF14433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14433_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 38 - 198
Target Start/End: Original strand, 17993179 - 17993338
Alignment:
| Q |
38 |
cgtttgaagaagattatacaactttcaagtttatgatttttaatgg-ttaaacaacaaatttgggatctaacctttctcaacaatcaccttcgttgtact |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17993179 |
cgtttgaagaagattatacaactttcaagtttatgatttttaatgggttaaacaacaaatttgggatctaacctttctcaacaatcaccttcgttgtact |
17993278 |
T |
 |
| Q |
137 |
cgaatggtggtataaggtagagagtttgtaggttttcttggtttggatttgtgagtataatg |
198 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
17993279 |
cgaatggtgg--taaggtagagagtttgtaggttttcttggtttgggtttgtgagtttaatg |
17993338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 59 - 117
Target Start/End: Complemental strand, 19318461 - 19318403
Alignment:
| Q |
59 |
ctttcaagtttatgatttttaat-ggttaaacaacaaatttgggatctaacctttctcaa |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || ||||||||||||| ||||||||||| |
|
|
| T |
19318461 |
ctttcaagtttatgatttttaataggttaaataaaaaatttgggatct-acctttctcaa |
19318403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University