View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14434_high_8 (Length: 373)
Name: NF14434_high_8
Description: NF14434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14434_high_8 |
 | |
|
| [»] scaffold0291 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 1 - 357
Target Start/End: Original strand, 29048136 - 29048492
Alignment:
| Q |
1 |
cttgctgtctggcatggcacacaagctgatgaggcttttcctgatgcttggcattccgattcaatgtctcctaatgaaagcttttcagctaactatgctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29048136 |
cttgctgtctggcatggcacacaagctgatgaggcttttcctgatgcttggcattccgattcaatgtctcctaatgaaagcttttcagctaactatgctc |
29048235 |
T |
|
| Q |
101 |
agattcggtctaaagtctacacttctccaaggttatggtacctacgtgtgaaagtgattgaggcacacgacttggtttcacacgacaacaagtctagagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29048236 |
agattcggtctaaagtctacacttctccaaggttatggtacctacgtgtgaaagtgattgaggcacacgacttggtttcacacgacaacaagtctagagc |
29048335 |
T |
|
| Q |
201 |
tcctgatgcttttgttaaggtgcaacatggtaaccagattttcaagacaaaaccggttcaatcaagaatcaataacccgcggtgggatcaaggtactttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29048336 |
tcctgatgcttttgttaaggtgcaacatggtaaccagattttcaagacaaaaccggttcaatcaagaatcaataacccgcggtgggatcaaggtactttg |
29048435 |
T |
|
| Q |
301 |
tttgttgctgctgaaccctttgaagaacctttgatcattacggttgaagataaggat |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29048436 |
tttgttgctgctgaaccctttgaagaacctttgatcattacggttgaagataaggat |
29048492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 205 - 335
Target Start/End: Complemental strand, 11704147 - 11704017
Alignment:
| Q |
205 |
gatgcttttgttaaggtgcaacatggtaaccagattttcaagacaaaaccggttcaatcaagaatcaataacccgcggtgggatcaaggtact-ttgttt |
303 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||| ||||||||||| ||||||||||| | ||| ||| ||| ||||||| ||| || ||||| |
|
|
| T |
11704147 |
gatgcttatgttaaggtgcagactggtaaccagattttgaagacaaaacccgttcaatcaaggaccaaaaacatgcgttgggatc-aggagctgatgttt |
11704049 |
T |
|
| Q |
304 |
gttgctgctgaaccctttgaagaacctttgat |
335 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |
|
|
| T |
11704048 |
gttgctgctgaacccttcgatgaacctttgat |
11704017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 4417 - 4373
Alignment:
| Q |
19 |
acacaagctgatgaggcttttcctgatgcttggcattccgattca |
63 |
Q |
| |
|
|||||||||||||| ||||||||||| || |||||||| |||||| |
|
|
| T |
4417 |
acacaagctgatgaagcttttcctgaggcatggcattcagattca |
4373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University