View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14434_low_4 (Length: 473)

Name: NF14434_low_4
Description: NF14434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14434_low_4
NF14434_low_4
[»] chr1 (3 HSPs)
chr1 (244-473)||(14568338-14568567)
chr1 (338-469)||(14576045-14576176)
chr1 (20-115)||(14568649-14568738)


Alignment Details
Target: chr1 (Bit Score: 166; Significance: 1e-88; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 244 - 473
Target Start/End: Complemental strand, 14568567 - 14568338
Alignment:
244 gttgatctgtagtataacttgatatttgacttgactaattattttcactcgtttcacttctacagaaagagacaaaacttgacagtagggactctgtcca 343  Q
    |||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||| |||||||||| ||||||||| | | |||||| ||||||||    
14568567 gttgatatgtagtataacttggtatttgacttgactaattattttcactcatttcacttttacagaaagaaacaaaacttcatattagggattctgtcca 14568468  T
344 tggtgcagatggacttggcaaccaaaatttcccaccaccaaacgggaaacccattgaagaatcagctgcttcttttttagttaaccaagcaaaagctaac 443  Q
    |||||||||||||||||||||||||||||| ||||||||||| || |||||| ||||||||||||||||| ||||||| |||||||||||||||||||||    
14568467 tggtgcagatggacttggcaaccaaaattttccaccaccaaatggaaaaccccttgaagaatcagctgctgctttttttgttaaccaagcaaaagctaac 14568368  T
444 cgtggaaaaaccacggttgtggcattaggt 473  Q
    |||||||||| |||||||||||||||||||    
14568367 cgtggaaaaatcacggttgtggcattaggt 14568338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 338 - 469
Target Start/End: Complemental strand, 14576176 - 14576045
Alignment:
338 tgtccatggtgcagatggacttggcaaccaaaatttcccaccaccaaacgggaaacccattgaagaatcagctgcttcttttttagttaaccaagcaaaa 437  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||    
14576176 tgtccatggtgcagatggacttggcaaccaaaattttccaccaccaaatgggaaacccattgaagaatcagctgcttcttttttggttaaccaagcaaaa 14576077  T
438 gctaaccgtggaaaaaccacggttgtggcatt 469  Q
    |||||||  ||||||| ||| || ||||||||    
14576076 gctaaccccggaaaaatcactgtcgtggcatt 14576045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 20 - 115
Target Start/End: Complemental strand, 14568738 - 14568649
Alignment:
20 ctttagattaaagacatggtcagtgtcgtgacacatgtggatgtggttacactcaatcatttattattggtgtcaatgtgtcagtttctgtgtcgt 115  Q
    ||||||||||||||||||  |||||||| || ||||||||      |||||||||||||||||||||||||||||| ||||||| |||||||||||    
14568738 ctttagattaaagacatgtccagtgtcgggaaacatgtgg------ttacactcaatcatttattattggtgtcaacgtgtcagattctgtgtcgt 14568649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University