View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_high_38 (Length: 363)
Name: NF14435_high_38
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 44 - 352
Target Start/End: Original strand, 48235319 - 48235627
Alignment:
| Q |
44 |
ataaaaatctagctgatcctactgacggccttcaacaattgatttcaggtaggcataggaggtcgtagtgaatggctattattcttagtatcagtaaaaa |
143 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48235319 |
ataaaaatctagctgatcctacggacggccttcaacaattgatttcaggtaggcataggaggtcgtagtgaatggctattattcttagtatcagtaaaaa |
48235418 |
T |
 |
| Q |
144 |
cttgattatcattacatccaaggcctcttaatctattaagctctggaagcacaactgatgcaagatttggcctatctttcttgcagagttctgcacaatt |
243 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48235419 |
cttgattatcattaaatccaaggcctcttaatctattaagctctggaagcacaactgatgcaagatttggcctatctttcttgcagagttctgcacaatt |
48235518 |
T |
 |
| Q |
244 |
caatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcaccgcagaatcaagaatctccgaaaactgctccttttcaattgccctttta |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
48235519 |
caatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcaccgcagaatcaagaatctctgaaaactggtccttttcaattgccctttta |
48235618 |
T |
 |
| Q |
344 |
acatgatga |
352 |
Q |
| |
|
||||||||| |
|
|
| T |
48235619 |
acatgatga |
48235627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 242 - 294
Target Start/End: Complemental strand, 42674307 - 42674255
Alignment:
| Q |
242 |
ttcaatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcac |
294 |
Q |
| |
|
||||| |||||||| |||| ||||| ||||||||| || |||||||||||||| |
|
|
| T |
42674307 |
ttcaaagctaatttagcaagtgataaagcctcttcgaccggccaatcagtcac |
42674255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University