View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_high_47 (Length: 312)
Name: NF14435_high_47
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 296
Target Start/End: Complemental strand, 41335923 - 41335642
Alignment:
| Q |
15 |
tatgaaatagaagtactaataattattctctaacacaatttttaaaatagtctcgtctattcagttgaaatttaaattttactagctaaattattataga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41335923 |
tatgaaatagaagtactaataattattctctaacacaatttttaaaatagtctcgtctattcagttgaaatttaaattttactagctaaattattataga |
41335824 |
T |
 |
| Q |
115 |
ttcggtaaaatttaattaatagaaacaagtgtgttnnnnnnntatgtgttatacatcatgacatagcatttttctttatcaaaatgcaacaacttggatg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41335823 |
ttcggtaaaatttaattaatagaaacaagtgtgttaaaaaaatatgtgttatacatcatgacatagcatttttctttatcaaaatgcaacaacttgggtg |
41335724 |
T |
 |
| Q |
215 |
gannnnnnnnnnnnnnnngacaaaacaaacatggatctcttattnnnnnnnttataaaacagtcaagttttaatgtcaataa |
296 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41335723 |
gatctctctctctctcttgacaaaacaaacatggatctcttattaaaagaattataaaacagtcaagttttaatgtcaataa |
41335642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University