View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_high_48 (Length: 309)
Name: NF14435_high_48
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_high_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 31839815 - 31840102
Alignment:
| Q |
1 |
attattcttgcttcttttgccttaacattggttgatagctat--gaactatatatgttgtctttcataaaggcttttagtcttatttgtatctcggtctt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
31839815 |
attattcttgcttcttttgccttaacattggttgatagctataggaactatatatgttgtctttcttagaggcttttagtcttatttgtatctcggtctt |
31839914 |
T |
 |
| Q |
99 |
gttgttaggagcctaattcctacttattcatannnnnnnnnagagaatttgatattttaattgaaattaattgatgaaactgggttttcaattttcatga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31839915 |
gttgttaggagcctaattcctacttattcata---ttttttagagaatttgatatt----------ttaattgatgaaactgggttttcaattttcatga |
31840001 |
T |
 |
| Q |
199 |
tgttt----ttgtatgtaactttgaaatctcgtgaatggtgaatgtcgtatagctctgccaccaaattaaggttgctttcataatgaacatattggttgt |
294 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31840002 |
tgtttttaattgtatgtaactttcaaatctcgtgaatggtgaatgtcgtatagctctgccaccaaattaaggttgcttccataatgaacatattggttgt |
31840101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University