View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_high_55 (Length: 273)
Name: NF14435_high_55
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_high_55 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 13091611 - 13091811
Alignment:
| Q |
1 |
ttgggtggatcacgtgaaggtttatttgggtgaaagagatacaaactgatgggatggggtctagtgtgggaagctaaaggcttatttgggaaaatataac |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||| | | ||| ||||| ||||||| ||||||||||||||||||| |
|
|
| T |
13091611 |
ttgggtggatcatgtgaaggtttatttgggtgaaagagatacaaactcatgg-atgggtt-tggtgagggaaactaaaggtttatttgggaaaatataac |
13091708 |
T |
|
| Q |
101 |
tacctaagaaaattttggtattagaatatttttaaggtaagatacgtaaatgcatctgatgccgtcacgctatatatgagttgcggaaaacaattgcttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||| ||| |
|
|
| T |
13091709 |
tacctaagaaaattttggtattagaatatttttaaggtaaggtacgtaaatgcatctgatgccgtcacgc----tatgaggtgcggaaaacaattgattt |
13091804 |
T |
|
| Q |
201 |
ctcctca |
207 |
Q |
| |
|
||||||| |
|
|
| T |
13091805 |
ctcctca |
13091811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 187 - 256
Target Start/End: Original strand, 13091887 - 13091956
Alignment:
| Q |
187 |
aaaacaattgctttctcctcacaattgatcttacataaggtctctatattgggcaagaaccaggggtgtt |
256 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13091887 |
aaaaaaattgctttctcctcacaattgatcttacataaggtctctatattgggcaagaaccaggggtgtt |
13091956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University