View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_high_63 (Length: 255)
Name: NF14435_high_63
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_high_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 8484467 - 8484697
Alignment:
| Q |
1 |
tttcatcctatcaagcgtcaactagctaatatttttgtgctcgagatgggtgtttttctctccatttcagagaagagtatatgatttcttcaacattgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8484467 |
tttcatcctatcaagcgtcaactagctaatatttttgtgctcgagatgggtgtttttctctccatttgagagaagagtatatgatttcttcaacattgtt |
8484566 |
T |
 |
| Q |
101 |
gagatgcaaaacctacacattgagagggaggataatggagacttggaactacccatggaaccaatacaacaagaagaagtcagttgcagttgtagcttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8484567 |
gagatgcaaaacctacacattgagaaggaggataatgaagacttggaactacccatggaaccaatacaacaagaagaagtcagttgc------agcttgt |
8484660 |
T |
 |
| Q |
201 |
gttatgtatagtgaggaggtttttgacatatgggcct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8484661 |
gttatgtatagtgaggaggtttttgacatataggcct |
8484697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University