View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_high_64 (Length: 253)
Name: NF14435_high_64
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_high_64 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 38014700 - 38014464
Alignment:
| Q |
17 |
tcaaacctgcttgcttccctgtttatgtttttatttgctttgtttgcagcttgagaaaggagagaatttcgttgatgtgcttaacccttgcacaaaaaag |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
38014700 |
tcaaacctgcttgcttccctgtttaagtttatatttgctttgtttgcagcttgaggaaggagaggatttcactgatgtgcttaacccttgcacaaaaaag |
38014601 |
T |
|
| Q |
117 |
gagactctagcatatggagactccaatatgcaaaatcttaagcgtggagaagtattacagctggagagaaagggatatttcaggtgtgatgtacccttcg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38014600 |
gagactctagcatatggagactccaatatgcgaaatcttaagcgtggagaagtattgcagctggagagaaagggatattttaggtgtgatgtacccttcg |
38014501 |
T |
|
| Q |
217 |
tctggccttcggaaccaaccgtgttatttgcaatccc |
253 |
Q |
| |
|
|| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
38014500 |
tccggccttcgaaaccaatcgtgttatttgcaatccc |
38014464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University