View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14435_high_76 (Length: 227)

Name: NF14435_high_76
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14435_high_76
NF14435_high_76
[»] chr2 (1 HSPs)
chr2 (18-212)||(45689891-45690085)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 45689891 - 45690085
Alignment:
18 gtttgtgtaatatcaaaaggatcgtcaggatcaacgaggaggtcatcgtcatcgtcgttggcagcggggctgtgagggtgagtgctgctagcaatggtga 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
45689891 gtttgtgtaatatcaaaaggatcgtcaggatcaacgaggaggtcatcgtcatcgtcgttggcagcggggccgtgagggtgagtgctgctagcaatggtga 45689990  T
118 cggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtcttcatgttttgcatgctattgctcatcttcctcttc 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45689991 cggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtcttcatgttttgcatgctattgctcatcttcctcttc 45690085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University