View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_101 (Length: 206)
Name: NF14435_low_101
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_101 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 45428085 - 45427908
Alignment:
| Q |
18 |
attgagtacatcggttcatttccatggtgtatgatacctggtatcagcaactgttcatatttgctttcatgcaatgctggtgccagcaagttaatttagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45428085 |
attgagtacatcggttcatttccatggtgtatgatacctggtatcagcaactgttcatatttgctttcatgcaatgctggtgccagcaagttaatttagt |
45427986 |
T |
 |
| Q |
118 |
ttgcaggacttgggccaacttttcctttgtttgggtatgctagatgctttcaattctatacctcgatttacatctctg |
195 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45427985 |
ttgcaggacttgggcctacttttcctttgtttgggtatgctagatgctttcaattctatacctcgatttacatttctg |
45427908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University