View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_102 (Length: 205)
Name: NF14435_low_102
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_102 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 187
Target Start/End: Original strand, 36064545 - 36064721
Alignment:
| Q |
11 |
gaagcaaaggttgagtgctaacaaacttgctggtatttctgtttcattgtttgcttaatttgagcaaaaaatcaaggaggaatagttggtgttgtttctc |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064545 |
gaagccaaggttgagtgctaacaaacttgctggtatttctgtttcattgtttgcttaatttgagcaaaaaatcaaggaggaatagttggtgttgtttctc |
36064644 |
T |
 |
| Q |
111 |
ttgttgagtaaatagattgctcctgttgttcttgtatattgaactatacattagaagggctttttagagggatcaag |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064645 |
ttgttgagtaaatagattgctcctgttgttcttgtatattgaactatacattagaagggctttttagagggatcaag |
36064721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University