View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_32 (Length: 439)
Name: NF14435_low_32
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 3e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 293 - 434
Target Start/End: Complemental strand, 46649090 - 46648950
Alignment:
| Q |
293 |
atcctgaaccttcaaccgcgaaaaactgccatttctgtcaggataaccgatcagaaagaacaaccggttaaatttgtaaatttctgaggaatacattact |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
46649090 |
atcctgaaccttcaaccgcgaaaaactgccatttctgacaggataaccaatcagaaagaacaactg-ttaaatttgtaaatttctgaggaatacattact |
46648992 |
T |
 |
| Q |
393 |
cgagaacgtttgggcgcgatgataaccaatccctttgcttct |
434 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
46648991 |
agagaacgtttgggcgcaatgataaccaatccctttggttct |
46648950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 189 - 295
Target Start/End: Complemental strand, 46651164 - 46651057
Alignment:
| Q |
189 |
tctgcacctaatgacgatgaagtggtcattctgaccaaagaaaaatatgaatggttgttgcagagg-ttgaccaggctgataagcttgaagggaagattt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46651164 |
tctgcacctaatgacgatgaagtggtcattatgaccaaagaaaaatatgaatggttgttgcagaggcttgaccaggctgataagcttgaagggaagattt |
46651065 |
T |
 |
| Q |
288 |
tacaaatc |
295 |
Q |
| |
|
|||||||| |
|
|
| T |
46651064 |
tacaaatc |
46651057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University