View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_45 (Length: 379)
Name: NF14435_low_45
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 40312257 - 40312488
Alignment:
| Q |
19 |
ttttttacttcttctagagataagacagcaaaaaattccggnnnnnnngagacnnnnnnncatttgctgccactggttttgttgaaaaccagaagaggnn |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40312257 |
ttttttacttcttctagagataagacagcaaaaaattccggtttttttgagacaaaaaaacatttgctgccactggttttgttgaaaaccagaaaaggaa |
40312356 |
T |
|
| Q |
119 |
nnnnnnn--gtaacggtttttaaggttgtgcgaacaaggatttcatgtttcactagttggaactattggtttttagttcagtttcacttctgaagtttct |
216 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40312357 |
aaaaaaaaagtaacggtttttaaggttgtgtgaacaaggatttcatgtttcactagttggaactattggtttttagttcagtttcacttctgaagtttct |
40312456 |
T |
|
| Q |
217 |
gtgatacttggtcttttttacttggttacaca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40312457 |
gtgatacttggtcttttttacttggttacaca |
40312488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 319 - 364
Target Start/End: Original strand, 40312559 - 40312604
Alignment:
| Q |
319 |
ctataaacacaacccttatttggggtcttaagagtgttctgtgctg |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40312559 |
ctataaacacaacccttatttggggtcttaagagtgttctgtgctg |
40312604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University