View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_47 (Length: 367)
Name: NF14435_low_47
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 196 - 350
Target Start/End: Complemental strand, 9877062 - 9876908
Alignment:
| Q |
196 |
atgctgtgaactgaaattgattttgaatttgttgatttagggttctgttaaggtttttagtgtttggtactgtgaattaaacttgaatttgtggatttat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877062 |
atgctgtgaactgaaattgattttgaatttgttgatttagggttctgttaaggtttttagtgtttggtactgtgaattaaacttgaatttgtggatttat |
9876963 |
T |
|
| Q |
296 |
gatgattttgttagggtttttagtgtttggtgtatgaactgaaaatgattttgat |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9876962 |
gatgattttgttagggtttttagtgtttggtgtatgaactgaaaatgattttgat |
9876908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 200 - 261
Target Start/End: Complemental strand, 9876802 - 9876741
Alignment:
| Q |
200 |
tgtgaactgaaattgattttgaatttgttgatttagggttctgttaaggtttttagtgtttg |
261 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
9876802 |
tgtgaattgaaattgattttgaatttgttgatttaggcttctgctactgtttttagtgtttg |
9876741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University