View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_65 (Length: 288)
Name: NF14435_low_65
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 13796886 - 13797063
Alignment:
| Q |
1 |
attctttaagattaggatttaaaagacaaatatcatagagactatgagaggatgactatcctcgttgctgtctaggtttttaccacgtttaaataatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| || |
|
|
| T |
13796886 |
attctttaagattaggatttaaaagacaaatatcataaagactatgagaggatgactattctaattgctgtctaggtttttaccacgtttaaataattaa |
13796985 |
T |
 |
| Q |
101 |
acatatggggtaatgactgctcgtttgacttaacggaatagttcaacacatcatggtttattcaaaaaacaatatccc |
178 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13796986 |
acatatggggcaatgaccgctcgtttgacttaatggaatagttcaacacatcatggtttattcaaaaaacaatatccc |
13797063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University