View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_66 (Length: 284)
Name: NF14435_low_66
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 36064145 - 36063865
Alignment:
| Q |
1 |
aattcagcaaaattaaatagagaatctgaaatgaaaaatggtgaattaaacg---aaattgattgcaaaacttacaaggaggtcttgaggaagggcttca |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36064145 |
aattcagcaaaattaaatagagaatctgaaatgaaaaatggtgaattaaacggtgaaattgattgcaaaacttacaaggagatcttgaggaagggcttca |
36064046 |
T |
 |
| Q |
98 |
aggcgagatttttcagaaatggtatcaaatcttccactgcacattctcttcaatggaaccgttacaggattggattcaaaagcttcatcgttgtttgaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064045 |
aggcgagatttttcagaaatggtatcgaatcttccactgcacattctcttcaatggaaccgttacaggattggattcaaaagcttcatcgttgtttgaaa |
36063946 |
T |
 |
| Q |
198 |
caacaaccctttttcttccaagagcacgaccataactataagtatcaaaccctagcgtcatatctgaaaccgttcttctca |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36063945 |
caacaaccctttttcttccaagagcacgaccataactataagtatcaaaccctagcgtcatatctgaaaccgttcttctca |
36063865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University