View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_67 (Length: 276)
Name: NF14435_low_67
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_67 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 14 - 276
Target Start/End: Original strand, 7539761 - 7540023
Alignment:
| Q |
14 |
caaaggatgaaggaaataaaaaatgctgttggaattgatgaaaattgcacccaaaacattgttcatgtttcaaagaaaactcgtagtggcggaggagctt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7539761 |
caaaggatgaaggaaataaaaaatgctgttggaattgatgaaaattgcacccaaaacattgttcatgtttcaaagaaaactcgtagtggtggaggagctt |
7539860 |
T |
 |
| Q |
114 |
taaaagaaatgttttataaaccttcaccacatgtatataggatacttattgcagctattggtgttcatatatttcaaaatatttgtggagttgagggtan |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7539861 |
taaaagaaatgttttataaaccttcaccacatgtatataggatacttattgcagctattggtgttcatatatttcaaaatatttgtggagttgagggtat |
7539960 |
T |
 |
| Q |
214 |
nnnnnnatatagtccaagaatttttggaagaatgggaatcacagataagggtacacttctttt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7539961 |
ttttttatatagtccaagaatttttggaagaatgggaatcactgataagggtacacttctttt |
7540023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University