View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14435_low_80 (Length: 253)

Name: NF14435_low_80
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14435_low_80
NF14435_low_80
[»] chr1 (1 HSPs)
chr1 (17-253)||(38014464-38014700)


Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 38014700 - 38014464
Alignment:
17 tcaaacctgcttgcttccctgtttatgtttttatttgctttgtttgcagcttgagaaaggagagaatttcgttgatgtgcttaacccttgcacaaaaaag 116  Q
    ||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||||||| |||||  ||||||||||||||||||||||||||||    
38014700 tcaaacctgcttgcttccctgtttaagtttatatttgctttgtttgcagcttgaggaaggagaggatttcactgatgtgcttaacccttgcacaaaaaag 38014601  T
117 gagactctagcatatggagactccaatatgcaaaatcttaagcgtggagaagtattacagctggagagaaagggatatttcaggtgtgatgtacccttcg 216  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||    
38014600 gagactctagcatatggagactccaatatgcgaaatcttaagcgtggagaagtattgcagctggagagaaagggatattttaggtgtgatgtacccttcg 38014501  T
217 tctggccttcggaaccaaccgtgttatttgcaatccc 253  Q
    || |||||||| |||||| ||||||||||||||||||    
38014500 tccggccttcgaaaccaatcgtgttatttgcaatccc 38014464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University