View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_85 (Length: 244)
Name: NF14435_low_85
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_85 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 217
Target Start/End: Original strand, 54879637 - 54879845
Alignment:
| Q |
13 |
atgaacaaatttaatgaggttttttcagtatcagagcatttactattagacaacacctctagaaacaattttaagaaaaatgttcaaatacgagaaagtg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54879637 |
atgaacaaatttaatgaggttttttcagtatcagagcatttactattagacaacacctctagaaacaattttaagaaaaatgttcaaatatgagaaagta |
54879736 |
T |
 |
| Q |
113 |
agctt----tgacaatcgacatgttttaataccatttatgtttgatacttttagctttttagttttagaggatgtgaatattctacaacgagttcaaaaa |
208 |
Q |
| |
|
|| || |||||||| ||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54879737 |
agatttgactgacaatcaacatgttttaatatcatttatgtttgatacttttgactttttagtgttagaggatgtgaatattctacaacgagttcaaaaa |
54879836 |
T |
 |
| Q |
209 |
ggtttagcg |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
54879837 |
ggtttagcg |
54879845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University