View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_95 (Length: 225)
Name: NF14435_low_95
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_95 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 34274992 - 34275205
Alignment:
| Q |
1 |
gcagtctgagctctttggtgagaatggcatggcatgcccccaggatccatttggtcctgacgtcccaacaaggtgattt----tactcaaaatcagttaa |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34274992 |
gcagtctgagctctttggtgagaatggcatggcatgcccccaggatccatttggtcctgacgtcccaacaaggtgatttaatttactcaaaatcagttaa |
34275091 |
T |
 |
| Q |
97 |
ttttgtatcatcttgctaatgaaaatgttgagtaagaaaggaggttatgtctttgcaagtccttagatactgcatgcttcattttatgttattaaactag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34275092 |
ttttgtatcatcttgctaatgaaaatgttgagtaagaaaggaggttatgtctttgcaagtccttagatactgcatgcttcattttatgttattaaactag |
34275191 |
T |
 |
| Q |
197 |
gaaactgttcatca |
210 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34275192 |
gaaactgttcatca |
34275205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University