View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_96 (Length: 224)
Name: NF14435_low_96
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_96 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 34768239 - 34768038
Alignment:
| Q |
1 |
atgattgaatttgggttataattattatatataaaatatagtgatctgattatgattctgattctgatccgtctcattagttgcattgcaccttcaattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34768239 |
atgattgaatttgggttataattattatatataaaatatagtgatctgatt------------ctgatccgtctcattagttgcattgcaccttcaattg |
34768152 |
T |
|
| Q |
101 |
tgtcttcttgagtcaattaatggtgggtcattgatggtgtatttgatgtttggtcaggttcttagttgttaatttatgttaagtgtcattggtaatcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34768151 |
tgtcttcttgagtcaattaatggtgggtcattgatggtgtatttgatgtttggtcaggttcttagttgttaatttatgttaagtgtcattggtaatcttt |
34768052 |
T |
|
| Q |
201 |
gtcggtgatgatgt |
214 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
34768051 |
gtcggtgttgatgt |
34768038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University