View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14435_low_98 (Length: 213)
Name: NF14435_low_98
Description: NF14435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14435_low_98 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 20 - 143
Target Start/End: Complemental strand, 9847542 - 9847419
Alignment:
| Q |
20 |
aagtgatagaaattttatgaaaaatagtttcatcatgccaaatccttcaaattttgtttcgcctcctccccaatctatagacttgttcaacaatttctaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9847542 |
aagtgatagaaattttatgaaaaatagtttcatcatgccaaatccttcatatggtgtttcgcctcctcccccatctatagacttgttcaacaatttctaa |
9847443 |
T |
 |
| Q |
120 |
aattagtcaatttgttgtttctta |
143 |
Q |
| |
|
||| || ||||||||||||||||| |
|
|
| T |
9847442 |
aatcagacaatttgttgtttctta |
9847419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 145 - 194
Target Start/End: Complemental strand, 9847402 - 9847353
Alignment:
| Q |
145 |
ttcatatatggcaaaggaaaatgtatgtctggttttataaccttatatag |
194 |
Q |
| |
|
||||||||||| ||||| |||| |||||||| ||||||||||||||||| |
|
|
| T |
9847402 |
ttcatatatggtaaaggggaatgcatgtctggctttataaccttatatag |
9847353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University