View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14438_high_23 (Length: 346)
Name: NF14438_high_23
Description: NF14438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14438_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 34 - 217
Target Start/End: Complemental strand, 43232228 - 43232045
Alignment:
| Q |
34 |
agagaagacaaatcgagttgaagtggattaaaaatcaagtcaacctaaataagtatgtaataagggatcatgaaggcatttacacacacacaatagattt |
133 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43232228 |
agagaagacaaaacgagttgaagtggattaaaaatcaagtcaacgtaaataagtatgtaataagggatcatgaaggcatttacacacacacaatagattt |
43232129 |
T |
|
| Q |
134 |
gaaattttgaattctaaatcatcttccaagagaatcccaatttagctttctgtgtgtaacaaatatcaagtagaggtcttatat |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43232128 |
gaaattttgaattctgcatcatcttccaagagaatcccaatttagctttctgtgtgtaacaaatatcaagtagaggtctcatat |
43232045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 213 - 262
Target Start/End: Complemental strand, 43232018 - 43231969
Alignment:
| Q |
213 |
tatatacaagtaagatgacccgtaaacataatatgatattatggttttgg |
262 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43232018 |
tatatacaagtaagatgacccataaacataatatgatattatggttttgg |
43231969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University