View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14438_high_44 (Length: 236)
Name: NF14438_high_44
Description: NF14438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14438_high_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 222
Target Start/End: Original strand, 47502809 - 47503023
Alignment:
| Q |
8 |
gaagtataccagggtacacgatgatggtactccacaacaaggttaatttcttaaagaaaatcgacgatcccatggcagtgttccacacccacgccatagc |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47502809 |
gaagtataccatggtacacgatgatggtactccacaacaaggttaatttcttaaagaaaatcgatgatcccatggcagtgttccacacccacgccatagc |
47502908 |
T |
 |
| Q |
108 |
tggtgctcttggtggcattctcactggcttctttgccgtgcctaaactatgtcgtctcttctatttggtgcctgattgggaaaaatacattggtcttgcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47502909 |
tggtgctcttggtggcattctcactggcttctttgccgtgcctaaactatgtcgtctcttctatatggtgcctgattgggaaaaatacattggtcttgcc |
47503008 |
T |
 |
| Q |
208 |
tatggcctacaaaat |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47503009 |
tatggcctacaaaat |
47503023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University