View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14438_low_14 (Length: 420)
Name: NF14438_low_14
Description: NF14438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14438_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 356; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 384
Target Start/End: Complemental strand, 17327742 - 17327359
Alignment:
| Q |
1 |
tctggttatactggaccttctatgaaccctgctaatgcatttggttgggcttatatgaacaataagcacaatacttgggagcaattttatgttttttgga |
100 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17327742 |
tctggctacactggaccttctatgaaccctgctaatgcatttggttgggcttatatgaacaataagcacaatacttgggagcaattttatgttttttgga |
17327643 |
T |
|
| Q |
101 |
tatgtcctttaattggtgctagttctgctgctatggtttatcggtttctatttatgtcaccagttaaggagaagaaagcttgagtcgagggacttagttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17327642 |
tatgtcctttaattggtgctagttctgctgctatggtttatcggtttctatttatgtcaccagttaaggagaagaaagcttgagtcgagggactttgttc |
17327543 |
T |
|
| Q |
201 |
taaattgcggtccacaatcataattatgggcgtatcataaaggttttagaggtctctgcaacgacttctccattgctatgactaaataatttgcctgtat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17327542 |
taaattgcggtccacaatcataattatgggcgtatcataaaagttttagaggtctctgcaacgacttttccattgctatgactaaataatttgcctgtat |
17327443 |
T |
|
| Q |
301 |
tttgcagcaatatcaaagttcgcagcgtaactgcaactataatttagaagcaagagagagtgtgaactagttatgattctacac |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17327442 |
tttgcagcaatatcaaagttcgcagcgtaactgcaacaatagtttagaagcaagagagagtgtgaactagttatgattctacac |
17327359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 237 - 265
Target Start/End: Original strand, 5998380 - 5998408
Alignment:
| Q |
237 |
ataaaggttttagaggtctctgcaacgac |
265 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5998380 |
ataaaggttttagaggtctctgcaacgac |
5998408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 339
Target Start/End: Complemental strand, 13380900 - 13380851
Alignment:
| Q |
290 |
tttgcctgtattttgcagcaatatcaaagttcgcagcgtaactgcaacta |
339 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
13380900 |
tttgcctgtaccttgcctcaatatcaaagttcgcagcttaactgcaacta |
13380851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University