View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14438_low_26 (Length: 337)
Name: NF14438_low_26
Description: NF14438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14438_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 26583309 - 26583212
Alignment:
| Q |
1 |
ccctgcataaagatggcttctcgccacaatgaagacaacacacgcaaaattctatatagtctcactagagaattacctcaacgattcgccgcatctcg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26583309 |
ccctgcataaagatggcttctcgccacaatgaagacaacacacgcaaaattctatatagtctcactagagaattacctcaacgattcgccgcatctcg |
26583212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 261 - 307
Target Start/End: Complemental strand, 26583183 - 26583137
Alignment:
| Q |
261 |
ggatttactaaagttagtgttctaagaaaatttcttaatgtactcta |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26583183 |
ggatttactaaagttagtgttctaagaaaatttcttaatgtactcta |
26583137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University