View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14438_low_30 (Length: 304)
Name: NF14438_low_30
Description: NF14438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14438_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 294
Target Start/End: Complemental strand, 29765169 - 29764887
Alignment:
| Q |
18 |
cccagccccaaaaaccaaaagaagggagcgtg-taacctatacacggttagca-------gtttggattagaaaaccttcacgcacaaaaaactgaaaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29765169 |
cccagccccaaaaaccaaaagaagggagcgtggtaacctatacatggttagcacttagcagtttggattagaaaaccttcacgcacaaaaaactgaaa-- |
29765072 |
T |
|
| Q |
110 |
tgcacattttagcgattatcctttgtcgagcagcgagacaatttccattcagtctgcttggatttgggcttcttgagcttggaaatgaatccatcatcat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29765071 |
tgcacattttagcgattatcctttgtcgagcagcgagacaatttccattcagtctgcttggatttgggcttcttgagcttggaaatgaatccatcatcat |
29764972 |
T |
|
| Q |
210 |
cggattcatcgctgttatcacctttcttcttaccacgtttcttctcagcttttccacaaaccacaattctgctttcgttcttctc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29764971 |
cggattcatcgctgttatcacctttcttcttaccacgtttcttctcagcttttccacaaaccacaattctgctttcgtccttctc |
29764887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University