View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14438_low_45 (Length: 247)
Name: NF14438_low_45
Description: NF14438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14438_low_45 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 155 - 247
Target Start/End: Complemental strand, 23470761 - 23470669
Alignment:
| Q |
155 |
taagttcttttaactatattttgtccaaagtttggatatccatccttggccgatcgcatgcgaaaatatttgtaggaagagctcaacctctta |
247 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
23470761 |
taagttcttttaactatattttgtcgaaagtttggatatccatccttggccggtcgcatgcaaaaatatttgtaggaagaggtcaacctctta |
23470669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 23470799 - 23470759
Alignment:
| Q |
7 |
tagataatactagaaattctataaccacaattcttaaataa |
47 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23470799 |
tagaaaatactagaaattctataaccacaattcttaaataa |
23470759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University