View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14438_low_45 (Length: 247)

Name: NF14438_low_45
Description: NF14438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14438_low_45
NF14438_low_45
[»] chr1 (2 HSPs)
chr1 (155-247)||(23470669-23470761)
chr1 (7-47)||(23470759-23470799)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 155 - 247
Target Start/End: Complemental strand, 23470761 - 23470669
Alignment:
155 taagttcttttaactatattttgtccaaagtttggatatccatccttggccgatcgcatgcgaaaatatttgtaggaagagctcaacctctta 247  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |||||||||||    
23470761 taagttcttttaactatattttgtcgaaagtttggatatccatccttggccggtcgcatgcaaaaatatttgtaggaagaggtcaacctctta 23470669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 23470799 - 23470759
Alignment:
7 tagataatactagaaattctataaccacaattcttaaataa 47  Q
    |||| ||||||||||||||||||||||||||||||||||||    
23470799 tagaaaatactagaaattctataaccacaattcttaaataa 23470759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University