View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14439_high_22 (Length: 372)
Name: NF14439_high_22
Description: NF14439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14439_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 13 - 362
Target Start/End: Original strand, 4406017 - 4406369
Alignment:
| Q |
13 |
tcaaacacaactgcatcatgctatgatgagcggtg---cagaaaacagaggtgaaaatgaatgtgggctatcttgcgccttaggtgttgagggtcacgcc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4406017 |
tcaaacacaactgcatcatgctatgatgagcggtggcgcagaaaacagaggtgaaaatgaatgtgggctatcttgcgccttaggtgttgagggtcacgcc |
4406116 |
T |
|
| Q |
110 |
gaggatgcggagtcgggttatattgacccggaaagggctgttgttgggtcgggtcctaaatgtagaggctgcggagaacgggttgcttcggttgttgtgt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
4406117 |
gaggatgcggagtcgggttatattgacccggaaagggctgttgttgggtcgggtcctaaatgtagagggtgtggagaacgggttgcttcggttgttgtgt |
4406216 |
T |
|
| Q |
210 |
tgccgtgtcgacatttatgtgtttgtactgaatgtgacacacgtttcggtgtttgccccgtttgtttcactgttaaaaattcaaccgttgaggtttattt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4406217 |
tgccgtgtcgacatttatgtgtttgtactgaatgtgacacacgtttcggtgtttgccccgtttgtttcactgttaaaaattcaaccgttgaggtttattt |
4406316 |
T |
|
| Q |
310 |
atcttaggttgattttcacaatcacatgatgcatgtgtttgttcatcagaatt |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4406317 |
atcttaggttgattttcacaatcacatgatgcatgtgtttgttcatcagaatt |
4406369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University