View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14439_high_40 (Length: 276)
Name: NF14439_high_40
Description: NF14439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14439_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 105 - 259
Target Start/End: Original strand, 14906875 - 14907030
Alignment:
| Q |
105 |
caatataaacagtattaatgtgtgttatattttatgtgggacaaaccactannnnnnn-aattcataaaacactagcttaaagtctcataatttgtgttt |
203 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||| | ||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14906875 |
caatataaacaatattaatgtgtgttatattttatatgggacataacactattttttttaattcataaaacactagcttaaagtctcataacttgtgttt |
14906974 |
T |
 |
| Q |
204 |
aattcgtcaacttttcaatttcctttcaacttcacaccactgttctttttggtggt |
259 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14906975 |
aatttgtcaacttttcaatttcctttcaacttcacaccaatgttctttttggtggt |
14907030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University