View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14439_high_43 (Length: 259)
Name: NF14439_high_43
Description: NF14439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14439_high_43 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 42625859 - 42626117
Alignment:
| Q |
1 |
atacaaggaaaagaattttgttgacattagcaaggaagacttggatctaggttttattcttttaattatgttttcttttcgtaattaattttggattaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42625859 |
atacaaggaaaagaattttgttgacattagcaaggaagacttggatctaggttttattcttttaattatgttttcttttcgtaattaattttggattaat |
42625958 |
T |
 |
| Q |
101 |
gctatattgaacaaacactcaactttctgaagcatatttacgtttcattgataaaatatttgccagtatgccgtacagcggcatgtattcatggtaacta |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42625959 |
gctatattggacaaacactcaactttctgaagcatatttacgtttcattgataaaatatttgccagtatgccgtacagcggcatgtattcatggtaacta |
42626058 |
T |
 |
| Q |
201 |
tttgaacatgctaaatgtagtttgctgtttctgtaggtgataagaatgaggaaaaggaa |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42626059 |
tttgaacatgctaaatgtagtttgctgtttctgtaggtgataagaatgaggaaaaggaa |
42626117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University