View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14439_low_11 (Length: 454)
Name: NF14439_low_11
Description: NF14439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14439_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-150; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-150
Query Start/End: Original strand, 139 - 447
Target Start/End: Original strand, 23171475 - 23171781
Alignment:
| Q |
139 |
taactgcgtcttgcaatgatacagtatatggcaataaccagcagcaccaagttgttacggggcacttgaatagctgtcatgatttaaaatttaaacccca |
238 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
23171475 |
taactgcgtctgccaatgatacagtatatggcaataaccagcagcaccaagttgttacggggcacttgaattgctgtcatgatttaaaatttcaacccca |
23171574 |
T |
|
| Q |
239 |
atcatgtccaaatcaaaatcacaatcatgattgcgaccatattaactctgctttgtatttggataaaggtcgtcgcaacttgcaagcataactatcatca |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23171575 |
atcatgtccaaatcaaaatcacaatcatgattgcgaccatattaactctgctttgtatttgg--aaaggtcgtcgcaacttgcaagcataactatcatca |
23171672 |
T |
|
| Q |
339 |
cattgtaaacacaacaacagtttaaaaggatttggattcactgtagctcatgctcctaattactagcattcttatcacaagatcaatttttacgcattcg |
438 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
23171673 |
cattgtaaacacaacaacagtttaaaaggatttggattcactgtagctcatgctcctaattacaagcattcttatcacaagatcagtttttaggcattcg |
23171772 |
T |
|
| Q |
439 |
ttcatctca |
447 |
Q |
| |
|
||||||||| |
|
|
| T |
23171773 |
ttcatctca |
23171781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 28 - 94
Target Start/End: Original strand, 23171359 - 23171425
Alignment:
| Q |
28 |
tggacaattattggcaggttatgctaaggcgtcaactcaacttacttatttttattattaccggttc |
94 |
Q |
| |
|
||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23171359 |
tggacaactattggcaggttatgctaatgcgccaactcaacttacttatttttattattaccggttc |
23171425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University