View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14439_low_46 (Length: 246)
Name: NF14439_low_46
Description: NF14439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14439_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 60 - 230
Target Start/End: Original strand, 36364668 - 36364838
Alignment:
| Q |
60 |
ggaatttggttatttaattcatttggttgattctgagaaaaatggaatgtgaaaaatgtatcctcatcatcaccgatttaagttttgaaggctttgaatg |
159 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36364668 |
ggaatttggttatttaattcgtttggttgattctgagaaaaatggaatgtgaaaaatgtatcctcatcatcaccgatttagtaattgaaggctttgaatg |
36364767 |
T |
|
| Q |
160 |
agacacgatttagcaattagggaaaacatagttcttagtcttcttgacatcggtgtggtcaggcggtttgt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36364768 |
agacacgatttagcaattagggaaaacatagttcttagtcttcttgacatcggtgtggtcaggcggtttgt |
36364838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 60 - 166
Target Start/End: Original strand, 36390979 - 36391085
Alignment:
| Q |
60 |
ggaatttggttatttaattcatttggttgattctgagaaaaatggaatgtgaaaaatgtatcctcatcatcaccgatttaagttttgaaggctttgaatg |
159 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||| |||| |||| ||||||||||| |||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
36390979 |
ggaatttgtttagataattcgtttggcagattgtgaggcaaatagaatgtgaaaagtgtatcctcatcatcaccgattgagtaagtgaaggctttgaatg |
36391078 |
T |
|
| Q |
160 |
agacacg |
166 |
Q |
| |
|
||||||| |
|
|
| T |
36391079 |
agacacg |
36391085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University