View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14439_low_50 (Length: 207)
Name: NF14439_low_50
Description: NF14439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14439_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 1310724 - 1310916
Alignment:
| Q |
1 |
ttgctaatgaaaatatgttactggtatattcctgaacttattatagatagtatatttatatttataatatttaattctgaaactttctagatgtaaatta |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||| |
|
|
| T |
1310724 |
ttgctattgaaaatatgttactggtatattcctgaacttattatagatagtatatttatatttataatacttaattctgaaactttcaagaggtaaatta |
1310823 |
T |
 |
| Q |
101 |
aatatatatttcaattagtattaagattttttgttgatttattttaagatgaatttagaaaatgtattttggaaagaagaataaaggagatgt |
193 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
1310824 |
aatatatttttcaattagtattaagattttttgttgatttattttaagatgaatttagaaaatgtattttggaaataaaagtaaaggagatgt |
1310916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University