View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1443_high_2 (Length: 236)
Name: NF1443_high_2
Description: NF1443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1443_high_2 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 17 - 236
Target Start/End: Original strand, 3619695 - 3619903
Alignment:
| Q |
17 |
aataataaactattcatatagtgtagttttgatataatatttgatatcattgtgaatttgtttgaattatagtgagctaccctgattttgtataagctac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3619695 |
aataataaactattcatatagtgtagttttgatataatatttgatatcattgtgaatttgtttgaattatggtgagctaccctgattttgtataagctac |
3619794 |
T |
|
| Q |
117 |
aaagtgtatacaaaattggatgactcattgtgattcctgcaaacctactgcaatgatttttgaatctggtcgtgaacaaactgagagttgaagttttata |
216 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3619795 |
a-----------aaattggatgactcattgtgattcctgcaaacctactgcaatgatttttgaatctggtcgtgaacaaactgagagttgaagttttatt |
3619883 |
T |
|
| Q |
217 |
tttgattgataattacaaac |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3619884 |
tttgattgataattacaaac |
3619903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University