View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14441_low_11 (Length: 217)
Name: NF14441_low_11
Description: NF14441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14441_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 18 - 138
Target Start/End: Original strand, 9970225 - 9970345
Alignment:
| Q |
18 |
aggttggaatgattgctgcgaatgatggagttctactaagaaaccatattccgtgtatccttaggatacacttcaagggaaagtcgtattaagttgaatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||| |||||| | |
|
|
| T |
9970225 |
aggttggaatgattgctgcgaatgatggagttctactaagaaaccatattccgcgtatccttaggaaacacttcaagggaaagccgtattatgttgaact |
9970324 |
T |
 |
| Q |
118 |
tcttgatttgttcaatgaggt |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9970325 |
tcttgatttgttcaatgaggt |
9970345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 135 - 199
Target Start/End: Original strand, 9970423 - 9970487
Alignment:
| Q |
135 |
aggttgagtttcaaactgctgcaggacagatggtagatttgatcaccacactggaaggagaaaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
9970423 |
aggttgagtttcaaactgctgcaggacagatgatcgatttgatcaccacactggaaggagaaaaa |
9970487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University