View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14442_high_16 (Length: 205)
Name: NF14442_high_16
Description: NF14442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14442_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 21524059 - 21524247
Alignment:
| Q |
1 |
cctaactcggtctagcctattcccatccctattgattatattttatctttaatgaaaggaattggatatgttggtcaaggaagttttaggtataatccaa |
100 |
Q |
| |
|
|||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21524059 |
cctaactcagcctatcctattcccatccctattgattatattttatctttaatgaaaggaattggatatgttggtcaaggaagttttatgtataatccaa |
21524158 |
T |
|
| Q |
101 |
aatcacatgggatgctaatttcccccttgaaatctaccatttctttggagtacatttttctttcttcttattatttctagctcaccttt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21524159 |
aatcacatgggatgctaatttcccccttcaaatctaccatttctttggagtacatttttctttcttcttattatttctagctcaccttt |
21524247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 32 - 69
Target Start/End: Original strand, 21538622 - 21538659
Alignment:
| Q |
32 |
ttgattatattttatctttaatgaaaggaattggatat |
69 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
21538622 |
ttgattatattttatctttaatgaaagggattagatat |
21538659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University