View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14442_low_13 (Length: 248)
Name: NF14442_low_13
Description: NF14442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14442_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 7904011 - 7904224
Alignment:
| Q |
17 |
taacaacaacatttatttacaattggaccaagggagtgcttggatttgtttcaagactccaccctttagtttaagcttaaaagagacacatctttgaact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7904011 |
taacaacaacatttatttacaattggaccaagggagtgcttggatttgtttcaagactccaccctttagtttaagcttaaaagagacacatctttgaact |
7904110 |
T |
|
| Q |
117 |
taaaagggacacaacttcgcccttgtaaactctttcctatgttattttcttatctgttattttggttactaaatttactgaacctagcactaaggcattt |
216 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7904111 |
taaaagggacacaacttcgtccttgtacactctttcctatgttattttcttatctgttattttggttactaaatttactgaacctagcactaaggcattt |
7904210 |
T |
|
| Q |
217 |
gttgaagacgatca |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7904211 |
gttgaagacgatca |
7904224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University