View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14442_low_15 (Length: 206)
Name: NF14442_low_15
Description: NF14442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14442_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 8694647 - 8694478
Alignment:
| Q |
19 |
attgcaattagctaaaattttgagaaatcacggtgaattaaatatatgcactataacttattttgtccgttgatttacaatcagatggctcaaatttcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8694647 |
attgcaattagctaaaattttgagaaatcacggtgaattaaatatatgcactataacttattttgtccgttgatttacaatcagatggctcaaatttcaa |
8694548 |
T |
 |
| Q |
119 |
ctcggtctcgcacaaatattacaacagaaaatctcatttccgagacacaacacaagtcattgtttccatt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8694547 |
ctcggtctcgcacaaatattacaacagaaaatctcatttccgagacacaacacaagtcattgtttccatt |
8694478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University