View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14442_low_9 (Length: 277)

Name: NF14442_low_9
Description: NF14442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14442_low_9
NF14442_low_9
[»] chr2 (1 HSPs)
chr2 (189-262)||(9440551-9440624)


Alignment Details
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 189 - 262
Target Start/End: Original strand, 9440551 - 9440624
Alignment:
189 tacagctaatccaaacacaagttgtgtcttgaacaaaagacataacaatcaatttatgtgtttcacttcctcct 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||    
9440551 tacagctaatccaaacacaagttgtgtcttgaacaaaagacataacaatcaagctatgtgtttcacttcctcct 9440624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University