View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14443_low_4 (Length: 258)
Name: NF14443_low_4
Description: NF14443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14443_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 16 - 244
Target Start/End: Complemental strand, 14965849 - 14965621
Alignment:
| Q |
16 |
aatataaaggattttgatgtctctacaacgatataacagctgcaatataaaattttataggataccgaaaatgcaatgtaaaactatgatgtgaatgttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14965849 |
aatataaaggattttgatgtctctacaacgatataacagccacaatataaaattttgtaggataccgaaaatgcaatgtaaaactatgatgtgaatgttt |
14965750 |
T |
|
| Q |
116 |
ttatatatactttggttccatgaggcaacactgcatgtaaattgaagcaacattgtctttgtctttgtctcctcattctttcactaatcatgtgcttgaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14965749 |
ttatatatactttggttccatgaggcaacactgcatgtaaattgaagcaacattgtctttgtctttgtctcctcattctttcactaatcatgtgcttgaa |
14965650 |
T |
|
| Q |
216 |
accacgttctctttcacattctgctactt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14965649 |
accacgttctctttcacattctgctactt |
14965621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University