View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14444_high_5 (Length: 212)
Name: NF14444_high_5
Description: NF14444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14444_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 49376578 - 49376768
Alignment:
| Q |
1 |
atgacttctgatatattattttaccaaacaaaaacataggtgacttatgtcatggaaattcgtcaagagtggggcagactccaaagtttaaaaagatgcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49376578 |
atgacttctgatatattattttaccaaacaaaaacatagatgacttatgtcatggaaattcgtcaagagtggggcagactccaaagtttaaaaagatgcg |
49376677 |
T |
 |
| Q |
101 |
acaatatatttacatattattctcaacaaagtctttatgccttgtgcttcgatcttctttgtaaccgaaaaataaaatatgcttgcgccaata |
193 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49376678 |
aca--atatttacatattattctcaacaaagtctttatgccttgcgcttcgatcttctttgtaatcgaaaaataaaatatgcttgcgccaata |
49376768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University