View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14445_high_29 (Length: 377)
Name: NF14445_high_29
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14445_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 21 - 356
Target Start/End: Original strand, 53345702 - 53346027
Alignment:
| Q |
21 |
agagagtatatcaattaaaagtgattatatctgcctctcttcccccttactccagcaacgtagaataattattatggagacaacaataattttttagagt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53345702 |
agagagtatatcaattaaaagtgattatatctgtctctcttcccccttactccagcaacgaagattaattattatggagacaacaataattttttagagt |
53345801 |
T |
|
| Q |
121 |
tatagacgcaaacatagcaaacaatatgattaccggatgtctaaaatgggatggagacatggagtgggttgaattacaaatataggttgaaattttcatc |
220 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53345802 |
tatagacgcaaacatagcaaacagtatgattaccggatgtctaaaatgggatggagacatggagtgggttgaattacaaatataggttgaaattttcatc |
53345901 |
T |
|
| Q |
221 |
ctaccccacccggccacgggttgatccatcggtagcaaaacacaagaaaatatagctaatgcatgataatgaatttaattttactttcagattaaacatc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53345902 |
ctaccccacccggccacgggttgatccatcggtagcaaaacacaagaaaatatagctaatgcatgataatgaat----------tttcagattaaacatc |
53345991 |
T |
|
| Q |
321 |
acgtgtagtccttacagtgctaaaacctttataatt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
53345992 |
acgtgtagtccttacagtgctaaaacctttataatt |
53346027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University