View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14445_high_33 (Length: 340)
Name: NF14445_high_33
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14445_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 12 - 325
Target Start/End: Complemental strand, 40736993 - 40736681
Alignment:
| Q |
12 |
aaaggctagttactttccaactaagtgttatctcactactaatctaggtcataatccaaattatgatggaggagcattttacgcgcaagatttatcgtcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
40736993 |
aaaggctagttactttccaactaagtgttatctcactactaatctaggtcataatccaaattatgatggaggagtattttacgcgcaagatt-atcgtcc |
40736895 |
T |
 |
| Q |
112 |
gatgtgggacgagatggagcattggaccaagtaattctaattatattcttgatgaaccatggtcagtgaatggtggttgcattgatgattttacgggcac |
211 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736894 |
aatgtggggcaagatggagcattggaccaagtaattctaattatattcttgatgaaccatggttagtgaatggtggttgcattgatgattttacgggcac |
40736795 |
T |
 |
| Q |
212 |
atttcgtccgtgattttacctttgatagcttgattgatgataaattaaagaggtggaatgaggttcttgagtggcaagtatttagcgacgacatcgctta |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
40736794 |
atttcgtccgtgattttacctttgatagcttgattgatgataaattaaagaggtggaatgaggttcttgagtggcaagtatttagcgacgaaatcactta |
40736695 |
T |
 |
| Q |
312 |
tgttgttcttaact |
325 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40736694 |
tgttgttcttaact |
40736681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University