View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14445_low_24 (Length: 426)
Name: NF14445_low_24
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14445_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-156; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 9 - 342
Target Start/End: Original strand, 33750995 - 33751324
Alignment:
| Q |
9 |
tgccagctgcaagtgcaaatcgtgatttcaatttttgtttttgcagaagaatctgctatgtagaattttgctgtgcaatgtgcagctagctagtgtcttt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33750995 |
tgccagctgcaagtgcaaatcgtgatttcaatttttgtttttgcagaagaatctgctatgtagaattttgctgtgcaatgtgcagctag----tgtcttt |
33751090 |
T |
|
| Q |
109 |
cttgcttcaactacnnnnnnncacgaacaaaattgccttgatatatacctgcaagtgcaaatcgtgattttaatgtaatctgctttctaaaatattctac |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33751091 |
cttgcttcaactactttttttcacgaacaaaattgccttgatatatacctgcaactgcaaatcgtgattttaatgtaatctgctttctaaaatattgtac |
33751190 |
T |
|
| Q |
209 |
ttaatgtgtggctttgttgaattatattatagtataaatactagttctgttcactgattttgtctttttagcttaaagggttatatattcagcttcaatg |
308 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33751191 |
ttaatgtgtggctttattgaattatattatagtataaatactagttctgttcactgattttgtctttttagcttaaagggttatatattcagcttcaatg |
33751290 |
T |
|
| Q |
309 |
agtacattgttttttaataaggataagaatataa |
342 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |
|
|
| T |
33751291 |
agtgcattgttttttaataaggataagaatataa |
33751324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 15 - 75
Target Start/End: Original strand, 33719518 - 33719578
Alignment:
| Q |
15 |
ctgcaagtgcaaatcgtgatttcaatttttgtttttgcagaagaatctgctatgtagaatt |
75 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| ||||| ||||||||| ||| ||||||||| |
|
|
| T |
33719518 |
ctgcaagtgcaaatagtgatttcaatgtttgattttgaagaagaatccgctttgtagaatt |
33719578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 153 - 181
Target Start/End: Original strand, 32575995 - 32576023
Alignment:
| Q |
153 |
atacctgcaagtgcaaatcgtgattttaa |
181 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32575995 |
atacctgcaagtgcaaatcgtgattttaa |
32576023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University