View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14445_low_32 (Length: 370)
Name: NF14445_low_32
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14445_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 19 - 361
Target Start/End: Complemental strand, 39480839 - 39480497
Alignment:
| Q |
19 |
ctctggacatggaacacacacttcatccactgctggtggagttccggtgccaatggcgagtgtatttggttatgcaaatggcgtggcaagaggtatggct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480839 |
ctctggacatggaacacacacttcatccactgctggtggagttccggtgccaatggcgagtgtatttggttatgcaaatggcgtggcaagaggtatggct |
39480740 |
T |
 |
| Q |
119 |
cccggtgctcacattgcagtgtacaaagtgtgctggttcaatggctgttataactctgacatcatggctgcaatggatgtggcaatcagagacggtgtgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39480739 |
cccggtgctcacattgcagtgtacaaagtgtgctggttcaatggctgttataactctgacatcatggctgcaatggatgtggcaatcagagatggtgtgg |
39480640 |
T |
 |
| Q |
219 |
acgttctatccttgtctctaggcggtttcccggtgccactatatgatgatagtattgccattggaagctttcgagcaatggagaaagggatttcagttat |
318 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480639 |
acgttctatccttgtctctaggtggtttcccggtgccactatatgatgatagtattgccattggaagctttcgagcaatggagaaagggatttcagttat |
39480540 |
T |
 |
| Q |
319 |
atgtgcggcaggaaacaatggcccaatggcgatgtctgttgcc |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480539 |
atgtgcggcaggaaacaatggcccaatggcgatgtctgttgcc |
39480497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University