View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14445_low_42 (Length: 310)
Name: NF14445_low_42
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14445_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 14 - 289
Target Start/End: Original strand, 1021089 - 1021368
Alignment:
| Q |
14 |
catcatttcaataaacctaaccaacctagatatcatagcacttcagattaactaacacttgcactt-gtttttcaagttctt-gtttcccttcaaaacct |
111 |
Q |
| |
|
||||| |||| ||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
1021089 |
catcacttcagtaaacctaaccaacctagata-----gcacttcagattaac----acttgcactttgtttttcaagttctttgtttcccttcaaaacct |
1021179 |
T |
 |
| Q |
112 |
tcttcaacatttgtttttgtttaatatacgcatacacacgttcaaata-----------tacggtatatatataccacctgaaacaatgggttgtacggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
1021180 |
tcttcaacatttgtttttgtttaatatacgcatacagacgttcaaatacgtgtataatatacggtatatatataccacctgaaacaatgggttgcactgt |
1021279 |
T |
 |
| Q |
201 |
gtctaaactcgacaacgaagaaacggtacgacggtgcaaagaacgccgccgtctcatgaaggaagcactttacgctcgccactacctcg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1021280 |
gtctaaactcgacaacgaagaaacggtacgacggtgcaaagaacgccgccgtctcatgaaggaagcactttacgctcgccactacctcg |
1021368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University